First report of Pittosporum cryptic virus 1 in Pittosporum tobira in Lebanon

cg.contactraied.aboukubaa@ipsp.cnr.iten_US
cg.contributor.centerInternational Center for Agricultural Research in the Dry Areas - ICARDAen_US
cg.contributor.centerLebanese Agricultural Research Institute - LARIen_US
cg.contributor.centerInstitute for Sustainable Plant Protection - INSPPen_US
cg.contributor.funderInternational Center for Agricultural Research in the Dry Areas - ICARDAen_US
cg.contributor.projectCODIS - Corporate-Communication and Documentation Information Servicesen_US
cg.contributor.project-lead-instituteInternational Center for Agricultural Research in the Dry Areas - ICARDAen_US
cg.coverage.countryLBen_US
cg.coverage.regionWestern Asiaen_US
cg.creator.idAttar, Basem: 0000-0001-8016-7297en_US
cg.identifier.doihttps://doi.org/10.1007/s42161-019-00455-8en_US
cg.isijournalISI Journalen_US
cg.issn2239-7264en_US
cg.journalJournal of Plant Pathologyen_US
cg.reviewStatusPeer Reviewen_US
cg.subject.agrovoclebanonen_US
cg.volume102en_US
dc.contributorSaldarelli, Pasqualeen_US
dc.contributorAttar, Basemen_US
dc.contributorJreijiri, Fouaden_US
dc.contributorChoueiri, Eliaen_US
dc.creatorKubaa, Raied Abouen_US
dc.date.accessioned2020-11-12T22:34:41Z
dc.date.available2020-11-12T22:34:41Z
dc.description.abstractPittosporum tobira or Japanese pittosporum is an ornamental greenhouse plant widely used in landscaping and along roadsides, as well as in parks and gardens. In Lebanon, symptoms of chlorotic vein banding were observed on six plants of P. tobira growing in two gardens located in the Beqaa Valley. A total of 48 samples were randomly collected from several sites in the Beqaa Valley, including the two gardens. Samples were tested by DAS-ELISA (Loewe, Germany) for the presence of eggplant mottled dwarf virus and tomato spotted wilt virus. None of these two viruses was detected in the collected samples. Then, total RNA was extracted from six symptomatic and six symptomless plants and tested by RT-PCR for the presence of Pittosporum cryptic virus 1 (PiCV1), a recently described double stranded RNA virus that belongs to the genus Deltapartitivirus in the family Partitiviridae (Elbeaino et al. 2016). Two pairs of specific primers were designed based on the available sequence in GenBank (accession number LN680393): [PiCV1-cpF: (5’TGGCAGCATTACCGAAGGTT3’) and PiCV1-cpR: (5’TGTGTCGGCAATCAAAGGGA3’)] to target a 279 bp fragment of the coat protein gene, and [PiCV1-rdrp637: (5’ACTCGCACACAACTAACGGA3’) and PiCV1-rdrp1008: (5’CGGTGCTGCCACCTTCTTAT3’)] to target a 372 bp of the RNA-dependent RNA polymerase gene in RT-PCR. DNA amplicons were obtained from the six symptomatic plants while no amplification was observed from the six symptomless plants. To verify the nature of the DNA products, three RT-PCR amplicons were sequenced. BLAST analyses revealed 98–99% nucleotide identity with the Italian isolate Pit-MAIB in both amplified genes and 99–100% similarity among the Lebanese isolates. Sequences of the Lebanese isolates were deposited in GenBank as accession numbers LR735543-LR735544. To the best of our knowledge, this is the first report of PiCV1 in P. tobira in Lebanon. Partitiviruses have been mainly associated with cryptic infections in both plants and fungi (Roossinck 2013). PiCV1 was first reported on P. tobira in Italy. Although cryptic viruses have no known vectors and are not transmitted mechanically or by grafting, they are vertically transmitted at high rates by ovule or pollen (Guy and Gerard 2016). Therefore, PiCV1 has the potential to spread in other Lebanese regions and neighboring countries.en_US
dc.formatPDFen_US
dc.identifierhttps://mel.cgiar.org/reporting/downloadmelspace/hash/1d03109c8e48ec90d54adcbcd2afe026en_US
dc.identifier.citationRaied Abou Kubaa, Pasquale Saldarelli, Basem Attar, Fouad Jreijiri, Elia Choueiri. (6/12/2019). First report of Pittosporum cryptic virus 1 in Pittosporum tobira in Lebanon. Journal of Plant Pathology, 102.en_US
dc.identifier.statusOpen accessen_US
dc.identifier.urihttps://hdl.handle.net/20.500.11766/12031
dc.languageenen_US
dc.publisherSpringer Natureen_US
dc.rightsAll rights reserved; self-archive copy onlyen_US
dc.sourceJournal of Plant Pathology;102,(2019)en_US
dc.subjectpittosporum tobiraen_US
dc.subjectpittosporum cryptic virus-1en_US
dc.subjectrt-pcren_US
dc.subjectpicv1en_US
dc.titleFirst report of Pittosporum cryptic virus 1 in Pittosporum tobira in Lebanonen_US
dc.typeJournal Articleen_US
dcterms.available2019-12-06en_US
dcterms.hasVersionV7 - 2021-10-29en_US
mel.impact-factor1.152en_US

Files